Posted by on 4 grudnia 2018

W badaniu przeprowadzonym wśród społeczności, uczestnicy, u których miano przeciwciał odwrotnych wynosiło 64 lub więcej, uważano za wykazujących wcześniejsze zakażenie. Badania laboratoryjne
Wszystkie próbki zostały przetestowane w Centrum Kontroli i Zapobiegania Chorobom (CDC). Pośredni test fluorescencyjno-na przeciwciała stosowany do ilościowego oznaczania przeciwciał reaktywnych wobec E. chaffeensis przeprowadzono w sposób opisany uprzednio.15 Próbki surowicy badano również pod kątem przeciwciał przeciwko Rickettsia rickettsii, R. typhi i Coxiella burnetii za pomocą pośredniego testu fluorescencyjno-przeciwciało. Zagnieżdżony PCR dla rybosomalnego RNA 16S E. chaffeensis przeprowadzono na wszystkich próbkach pełnej krwi. Startery ECB (5 cgtattaccgcggctgctggcA3 ) i ECC (5 agaacgaacgctggcGgcaagcc3 ), które amplifikują wszystkie znane gatunki ehrlichia, zostały użyte w początkowym etapie amplifikacji.16 W przypadku nested PCR każdy produkt amplifikowano w dwóch oddzielnych mieszaninach reakcyjnych. Pierwsza mieszanina zawierała startery ECA (5aacacatgcaagtcgaacgga3 ) i HE3 (5 tataggtaccgtcattatctccctat3 ), które wzmacniają wszystkie znane gatunki ehrlichia. Druga mieszanina zawierała starter specyficzny dla E. chaffeensis HE1 (5 caattgcttataacctttTggttataaat3 ) i HE3.17 Te primery zostały użyte do sprawdzenia, czy wszystkie możliwe amplifikowane produkty były E. chaffeensis.
Kolekcja kleszczy
W sierpniu 1993 r. Kleszcze zebrano za pomocą standaryzowanych technik wzdłuż krawędzi torów wodnych zarówno w społeczności A, jak iw społeczności B. Ponadto 16 jeleni bielikowatych (Odocoileus virginianus) i 20 średnich ssaków zebrano w społeczności A i wokół niej oraz badane na kleszcze; ssaki te to 12 szopów (Procyon lotor), 4 oposy (Didelphis virginiana), 2 czerwone lisy (Vulpes vulpes), skunks (Mephitis mephitis) i świstak (Marmota monax). Pomimo licznych prób zebrania gryzoni, nie znaleziono żadnych. Kleszcze zidentyfikowano zgodnie ze standardowymi kryteriami morfologicznymi.
Analiza statystyczna
Testy istotności w badaniu kliniczno-kontrolnym przeprowadzono za pomocą testu Manna-Whitneya dla zmiennych ciągłych i dokładnego testu Fishera dla zmiennych dychotomicznych. 95-procentowe przedziały ufności dla wszystkich względnych ryzyk w serosurvey zostały obliczone metodą Grenlandii i Robins. Wszystkie analizy zostały wykonane przy pomocy Epi Info, pakietu oprogramowania dostarczonego przez CDC.18
Wyniki
Jedenaście przypadków objawowej, ostrej erlichiozy wystąpiło w trakcie sześciomiesięcznego okresu objętego badaniem (Tabela 1): cztery przypadki indeksowe, cztery przypadki zidentyfikowano retrospektywnie i trzy przypadki zidentyfikowane w wyniku poszukiwań prospektywnych. Opierając się na populacjach 35 000 osób w grupie referencyjnej, wskaźnik objawowej erlichiozy podczas sześciomiesięcznego okresu badania wynosił 31 przypadków na 100 000 populacji (roczna stopa 62 na 100 000). Dziesięciu przypadków pacjentów mieszkało we wspólnocie A; dlatego wskaźnik objawowej infekcji w tej społeczności wynosił 330 przypadków na 100 000. Nie wykryto zakażenia R. rickettsii, R. typhi lub C. burnetii.
Identyfikacja przypadków
Retrospektywne wyszukiwanie obejmowało wstępną weryfikację dokumentacji medycznej 76 pacjentów. Sześćdziesiąt jeden (80 procent) zostało zidentyfikowanych, ponieważ mieli leukopenię, małopłytkowość lub zapalenie wątroby lub zostali przetestowani na gorączkę plamistą Gór Skalistych lub boreliozę z Lyme
[patrz też: lekarstwo z orzecha włoskiego, dyżury aptek kluczbork, ile trwają studia medyczne ]

Comments

Be the first to comment.

Leave a Reply

You may use these HTML tags and attributes: <a href="" title=""> <abbr title=""> <acronym title=""> <b> <blockquote cite=""> <cite> <code> <del datetime=""> <em> <i> <q cite=""> <s> <strike> <strong>

*


Powiązane tematy z artykułem: dyżury aptek kluczbork ile trwają studia medyczne lekarstwo z orzecha włoskiego

Posted by on 4 grudnia 2018

W badaniu przeprowadzonym wśród społeczności, uczestnicy, u których miano przeciwciał odwrotnych wynosiło 64 lub więcej, uważano za wykazujących wcześniejsze zakażenie. Badania laboratoryjne
Wszystkie próbki zostały przetestowane w Centrum Kontroli i Zapobiegania Chorobom (CDC). Pośredni test fluorescencyjno-na przeciwciała stosowany do ilościowego oznaczania przeciwciał reaktywnych wobec E. chaffeensis przeprowadzono w sposób opisany uprzednio.15 Próbki surowicy badano również pod kątem przeciwciał przeciwko Rickettsia rickettsii, R. typhi i Coxiella burnetii za pomocą pośredniego testu fluorescencyjno-przeciwciało. Zagnieżdżony PCR dla rybosomalnego RNA 16S E. chaffeensis przeprowadzono na wszystkich próbkach pełnej krwi. Startery ECB (5 cgtattaccgcggctgctggcA3 ) i ECC (5 agaacgaacgctggcGgcaagcc3 ), które amplifikują wszystkie znane gatunki ehrlichia, zostały użyte w początkowym etapie amplifikacji.16 W przypadku nested PCR każdy produkt amplifikowano w dwóch oddzielnych mieszaninach reakcyjnych. Pierwsza mieszanina zawierała startery ECA (5aacacatgcaagtcgaacgga3 ) i HE3 (5 tataggtaccgtcattatctccctat3 ), które wzmacniają wszystkie znane gatunki ehrlichia. Druga mieszanina zawierała starter specyficzny dla E. chaffeensis HE1 (5 caattgcttataacctttTggttataaat3 ) i HE3.17 Te primery zostały użyte do sprawdzenia, czy wszystkie możliwe amplifikowane produkty były E. chaffeensis.
Kolekcja kleszczy
W sierpniu 1993 r. Kleszcze zebrano za pomocą standaryzowanych technik wzdłuż krawędzi torów wodnych zarówno w społeczności A, jak iw społeczności B. Ponadto 16 jeleni bielikowatych (Odocoileus virginianus) i 20 średnich ssaków zebrano w społeczności A i wokół niej oraz badane na kleszcze; ssaki te to 12 szopów (Procyon lotor), 4 oposy (Didelphis virginiana), 2 czerwone lisy (Vulpes vulpes), skunks (Mephitis mephitis) i świstak (Marmota monax). Pomimo licznych prób zebrania gryzoni, nie znaleziono żadnych. Kleszcze zidentyfikowano zgodnie ze standardowymi kryteriami morfologicznymi.
Analiza statystyczna
Testy istotności w badaniu kliniczno-kontrolnym przeprowadzono za pomocą testu Manna-Whitneya dla zmiennych ciągłych i dokładnego testu Fishera dla zmiennych dychotomicznych. 95-procentowe przedziały ufności dla wszystkich względnych ryzyk w serosurvey zostały obliczone metodą Grenlandii i Robins. Wszystkie analizy zostały wykonane przy pomocy Epi Info, pakietu oprogramowania dostarczonego przez CDC.18
Wyniki
Jedenaście przypadków objawowej, ostrej erlichiozy wystąpiło w trakcie sześciomiesięcznego okresu objętego badaniem (Tabela 1): cztery przypadki indeksowe, cztery przypadki zidentyfikowano retrospektywnie i trzy przypadki zidentyfikowane w wyniku poszukiwań prospektywnych. Opierając się na populacjach 35 000 osób w grupie referencyjnej, wskaźnik objawowej erlichiozy podczas sześciomiesięcznego okresu badania wynosił 31 przypadków na 100 000 populacji (roczna stopa 62 na 100 000). Dziesięciu przypadków pacjentów mieszkało we wspólnocie A; dlatego wskaźnik objawowej infekcji w tej społeczności wynosił 330 przypadków na 100 000. Nie wykryto zakażenia R. rickettsii, R. typhi lub C. burnetii.
Identyfikacja przypadków
Retrospektywne wyszukiwanie obejmowało wstępną weryfikację dokumentacji medycznej 76 pacjentów. Sześćdziesiąt jeden (80 procent) zostało zidentyfikowanych, ponieważ mieli leukopenię, małopłytkowość lub zapalenie wątroby lub zostali przetestowani na gorączkę plamistą Gór Skalistych lub boreliozę z Lyme
[patrz też: lekarstwo z orzecha włoskiego, dyżury aptek kluczbork, ile trwają studia medyczne ]

Comments

Be the first to comment.

Leave a Reply

You may use these HTML tags and attributes: <a href="" title=""> <abbr title=""> <acronym title=""> <b> <blockquote cite=""> <cite> <code> <del datetime=""> <em> <i> <q cite=""> <s> <strike> <strong>

*


Powiązane tematy z artykułem: dyżury aptek kluczbork ile trwają studia medyczne lekarstwo z orzecha włoskiego

SimpleShift from ThemeShift - WordPress